View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12870_low_9 (Length: 229)
Name: NF12870_low_9
Description: NF12870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12870_low_9 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 6 - 229
Target Start/End: Original strand, 15714394 - 15714617
Alignment:
| Q |
6 |
agtgtttatgttggcagtgtatatttggatgcagatgaacaatgggtgttacctagtgaaaatgttgttgaagaggatgatgtggatttggaatctgctg |
105 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
15714394 |
agtgttaatgttggaagtgtatatttggatgcagatgaacaatgggtgttacctagtgaaaatgttgttgaagaggatgatgtggatttggaatctgttg |
15714493 |
T |
|
| Q |
106 |
tgatgcatcaggttggtcatttactagggttggggcattcttctgttgaagaggctattatgtatccgattgtgttgcaagaaaagaagattgagttggt |
205 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15714494 |
tgatgcatcaagttggtcatttacttgggttggggcattcttctgttgaagaggctattatgtatccgattgtgttgcaagaaaagaagattgagttggt |
15714593 |
T |
|
| Q |
206 |
aaatgttgatgatttgcagaggat |
229 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
15714594 |
aaatgttgatgatttgcagaggat |
15714617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 15864411 - 15864362
Alignment:
| Q |
120 |
ggtcatttactagggttggggcattcttctgttgaagaggctattatgta |
169 |
Q |
| |
|
||||||||| ||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
15864411 |
ggtcatttattagggttagggcattcttccattgaagaggctattatgta |
15864362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University