View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12871_high_21 (Length: 368)
Name: NF12871_high_21
Description: NF12871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12871_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-137; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 35417207 - 35417458
Alignment:
| Q |
1 |
agcttcataagggtcaaaagttctcacatcacttttcaacaatgcggtgtgaatagcaacttctgaagcaaacaaatgtgttttacacctcccatttaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35417207 |
agcttcataagggtcaaaagttctcacatcacttttcaacaatgcggtgtgaatagcaacttctgaagcaaacaaatgtgttttacacctcccatttaca |
35417306 |
T |
 |
| Q |
101 |
agccaatcattgttgtattttgaaggtagctcataaacaaacaccttcaaatttttcaacatatctaatgagttatgagaaacaatgttggaattagaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35417307 |
agccaatcattgttgtattttgaaggtagctcataaacaaacaccttcaaatttttcaacatatctaatgagttatgagaaacaacgttggaattagaat |
35417406 |
T |
 |
| Q |
201 |
ttgagacaatggttgttatgtcttgtgggtcattggtgatgagataagaggt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35417407 |
ttgagacaatggttgttatgtcttgtgggtcattggtgatgagataagaggt |
35417458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 313 - 353
Target Start/End: Original strand, 35417519 - 35417559
Alignment:
| Q |
313 |
tgttttatgatggtcttgttgaggttttgtgttatgtttgt |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35417519 |
tgttttatgatggtcttgttgaggttttgtgttatgtttgt |
35417559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 21056104 - 21056021
Alignment:
| Q |
1 |
agcttcataagggtcaaaagttctcacatcacttttcaacaatgcggtgtgaatagcaacttctgaagcaaacaaatgtgtttt |
84 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||| | || || || | ||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
21056104 |
agcttcatatgggtcaaaagttcttacatcacttgttaataaagctctatgaatagcaacttctgaagcaaataaatgagtttt |
21056021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University