View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12871_high_32 (Length: 224)
Name: NF12871_high_32
Description: NF12871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12871_high_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 15 - 208
Target Start/End: Complemental strand, 3081534 - 3081338
Alignment:
| Q |
15 |
atgaacttactgaagtgattttagaaaatttcaataatataggaaatt-gagtccaaattatttaccatgttatatccactaccta----ggtaaaatat |
109 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| |||||| ||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3081534 |
atgaacttactgaagtgactttaagaaatttcgataata--ggaaatttgagtccaaattatttaccatgttatatccactacctacctaggtaaaatat |
3081437 |
T |
|
| Q |
110 |
ttgttactgttacttcattgacagaaggatcattggaagcttttgatgatgattcaccttccactacttttcttccaactgaaaatgctggatgattag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3081436 |
ttgttactgttacttcattgacagaaggatcattggaagcttttgatgttgattcaccttccactacttttcttccaactgaaaatgctggatgattag |
3081338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 84 - 208
Target Start/End: Complemental strand, 3095899 - 3095775
Alignment:
| Q |
84 |
ttatatccactacctaggtaaaatatttgttactgttacttcattgacagaaggatcattggaagcttttgatgatgattcaccttccactacttttctt |
183 |
Q |
| |
|
|||||||| ||||||||| |||| ||||| || ||| |||||||| ||||||||||| ||||||||||| |||| ||||| | | || |||||||||| |
|
|
| T |
3095899 |
ttatatcccctacctaggaaaaacatttgatattgtaacttcattaacagaaggatctttggaagctttagatgttgattgatcatcagttacttttctt |
3095800 |
T |
|
| Q |
184 |
ccaactgaaaatgctggatgattag |
208 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3095799 |
ccaactgaaaatgctggatgattag |
3095775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 85 - 142
Target Start/End: Original strand, 4547060 - 4547117
Alignment:
| Q |
85 |
tatatccactacctaggtaaaatatttgttactgttacttcattgacagaaggatcat |
142 |
Q |
| |
|
||||||| ||||||||| |||||||||| || |||||||||||| ||||||||||||| |
|
|
| T |
4547060 |
tatatcccctacctaggaaaaatatttgatattgttacttcattaacagaaggatcat |
4547117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University