View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12871_high_34 (Length: 214)
Name: NF12871_high_34
Description: NF12871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12871_high_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 33166297 - 33166120
Alignment:
| Q |
18 |
gaaatggcagtgggttggtggttttatgatgatttagtgcggtattaggtgatggaccataacgttcttttggtaggacgtgtgaatggaggggggtagc |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
33166297 |
gaaatggcagtgggtaggtggttttatgatgatttagtgcggtatt--gtgatggaccataacgttcttttggtaggacgtgtgaatgaagggggg-agc |
33166201 |
T |
|
| Q |
118 |
tttctgtgataggtttaagagaccgattgatttgggtaaaaacaatgaaattttggattttaagtgacgaagtctcgtaag |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
33166200 |
tttctgtgataggtttaagagaccgattaatttgggtaaaaacaatgaaattttggattttaagtgacaaagtctcataag |
33166120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University