View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12871_low_29 (Length: 270)
Name: NF12871_low_29
Description: NF12871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12871_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 48568717 - 48568909
Alignment:
| Q |
1 |
tacatgtgtcagttctaacttggaaatacacttatgcaagagcaggcggaaggccattcctcatcttgtctcctagataatagtcaacgctaatattatt |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48568717 |
tacatgtgtcagttttaacttggaaatacacttatgcaagagcaggcggaaggccattcctcatcttgtctcctagataatagtcaacgctaatattatt |
48568816 |
T |
 |
| Q |
101 |
tcagtcaattttgctagacaaattaattaggccatttccttaatccctgttagttttttaaagaactgaacttgtcttgacataattgctgcg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48568817 |
tcagtcaattttgctagacaaattaattaggccatttccttaatccctgttagttttttaaagaactgaacttgtcttgacataattgctgcg |
48568909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 196 - 260
Target Start/End: Original strand, 48568936 - 48569002
Alignment:
| Q |
196 |
ttctttaggtcactgcaaagagctc--gacagaagactctaccttcttctctatggagatacctatg |
260 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48568936 |
ttctttaggtcactgcaaagagctcttgacagaagactctaccttcttctctatggagatacctatg |
48569002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University