View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12872_high_19 (Length: 203)
Name: NF12872_high_19
Description: NF12872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12872_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 11 - 184
Target Start/End: Complemental strand, 3884183 - 3884010
Alignment:
| Q |
11 |
gtgagatgaaaggtaagtaccaaggtatactatagataagaattaatctttaagttacctttagattgtacacaagtttatcagtctcaacatcaattat |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884183 |
gtgaaatgaaaggtaagtaccaaggtatactatagataagaattaatctttaagttacctttagattgtacacaagtttatcagtctcaacatcaattat |
3884084 |
T |
 |
| Q |
111 |
tttgagattatttccagtagcagtagctagaagcatgccaaggggctggaatctaacttgtttactacctccct |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3884083 |
tttgagattatttccagtagcagtagctagaagcatgccaagaggctggaatctaacttgtttactacctccct |
3884010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University