View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12872_low_13 (Length: 286)
Name: NF12872_low_13
Description: NF12872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12872_low_13 |
 | |
|
| [»] scaffold0018 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0018 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 13 - 279
Target Start/End: Complemental strand, 34902 - 34636
Alignment:
| Q |
13 |
ttcactgttgatgaaagattgcgagtcactattgaaactgttgatgaagcacaaatttggttgggtttttaatgcccctgtggatgtggttaagttgaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34902 |
ttcactgttgatgaaagattgcgagtcactattgaaactgttgatgaagcacaaatttggttgggtttttaatgcccctgtggatgtggttaagttgaat |
34803 |
T |
|
| Q |
113 |
attcccgactatttcagtgtcataacgcatcctatggatttgggaacagtacaaaacaagattgctaaaggatcatacacaggcccattggaatttgctg |
212 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34802 |
attcctgactatttcagtgtgataacgcatcctatggatttgggaacagtacaaaacaagattgctaaaggatcatacacaggcccattggaatttgctg |
34703 |
T |
|
| Q |
213 |
ctgatgtgaggcttacattttcaaatgcgttgagttataatccacctaagactgatgtccatctcat |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34702 |
ctgatgtgaggcttacattttcaaatgcgttgagttataatccacctaagactgatgtccatatcat |
34636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 47224 - 46984
Alignment:
| Q |
18 |
tgttgatgaaagattgcgagtcactattgaaactgttgatgaagcacaaatttggttgggtttttaatgcccctgtggatgtggttaagttgaatattcc |
117 |
Q |
| |
|
|||||||||||||||| |||||||| |||| || |||||||| ||| | | |||||||||||| || ||||||||||||| || |||||||| |||| |
|
|
| T |
47224 |
tgttgatgaaagattgtgagtcacttttgacacggttgatgactcaccagtatggttgggttttcaacacccctgtggatgtagtcaagttgaaccttcc |
47125 |
T |
|
| Q |
118 |
cgactatttcagtgtcataacgcatcctatggatttgggaacagtacaaaacaagattgctaaaggatcatacacaggcccattggaatttgctgctgat |
217 |
Q |
| |
|
|| ||||||| | |||| | | | |||||||||||||||||| || ||| |||||| | | || | ||| | | ||||||||||||||||| ||| |
|
|
| T |
47124 |
tgattatttcactatcattaaggaacctatggatttgggaacaataaaaagcaagatcgatgccagagcgtactctgacccattggaatttgctggtgac |
47025 |
T |
|
| Q |
218 |
gtgaggcttacattttcaaatgcgttgagttataatccacc |
258 |
Q |
| |
|
||||||||||| ||||| ||||| ||| ||||||||||| |
|
|
| T |
47024 |
gtgaggcttacgttttcgaatgcaatgacctataatccacc |
46984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 66 - 156
Target Start/End: Original strand, 34066404 - 34066494
Alignment:
| Q |
66 |
aatttggttgggtttttaatgcccctgtggatgtggttaagttgaatattcccgactatttcagtgtcataacgcatcctatggatttggg |
156 |
Q |
| |
|
||||||||||||||||||||| || || ||||| ||||| ||||| ||||| || ||||||| |||||| | ||||| ||||||||||| |
|
|
| T |
34066404 |
aatttggttgggtttttaatgaaccagtcgatgttgttaaattgaacattccggattatttcaatgtcatcaaacatccaatggatttggg |
34066494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University