View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12872_low_17 (Length: 262)
Name: NF12872_low_17
Description: NF12872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12872_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 104 - 252
Target Start/End: Complemental strand, 2676689 - 2676544
Alignment:
| Q |
104 |
ttcctatttccttttgatgtgctaatatcatcttatgggaaggattttccttgattgataaaatgtattctcactatcattcnnnnnnnnnnaacaaaat |
203 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
2676689 |
ttcctatttccttt-gatgtgctaatatcatcttatgggaaggattttccttgattgataaaatgtattttcactatcatt-tctttttttaaacaaaa- |
2676593 |
T |
 |
| Q |
204 |
tatcactatcaagttatgtaaagaagttacagtaattacatggtctgtg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
2676592 |
tatcactatcaagttatgtaaagaagttacaataattacatggtgtgtg |
2676544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 17 - 73
Target Start/End: Complemental strand, 2678333 - 2678277
Alignment:
| Q |
17 |
aattaaatcatctaaaaatctataataaaccgattagacatccaaaataaaaaactt |
73 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2678333 |
aattaaatcatctaaaaatttataataaaccgattagacatccaaaataaaaaactt |
2678277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 69
Target Start/End: Complemental strand, 30701365 - 30701319
Alignment:
| Q |
23 |
atcatctaaaaatctataataaaccgattagacatccaaaataaaaa |
69 |
Q |
| |
|
|||||||||||||||||||| || |||| |||||| ||||||||||| |
|
|
| T |
30701365 |
atcatctaaaaatctataatgaatcgataagacattcaaaataaaaa |
30701319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University