View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12872_low_18 (Length: 248)
Name: NF12872_low_18
Description: NF12872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12872_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 43307620 - 43307382
Alignment:
| Q |
1 |
ctatgctaagattattcgccacaacctaattaagaccccttctaaagacgaaataggccttaattaaaatgtggacctaaccagggaagaannnnnnnaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
43307620 |
ctatgctaagattattcgccacaacctaattaagaccccttataaagacgaaataggccttaatgaaaatgtggacctaaccagggaagaatttttttaa |
43307521 |
T |
 |
| Q |
101 |
attcatcgcaacaaacgcttttacgttggtgaagaggaatatcgattttaaaagacccttggttttgaagaaaccctaaaaaacaatatttataacatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43307520 |
attcatcgcaacaaacgcttttacgttggtgaagagaaatatcgattttaaaagacccttggttttgaagaaaccctaaaaaacaatatttataacatta |
43307421 |
T |
 |
| Q |
201 |
tgcctggaatacttttattttatgtttgtagtacctttg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43307420 |
tgcctggaatacttttattttatgtttgtagtacctttg |
43307382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University