View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12873_high_13 (Length: 356)
Name: NF12873_high_13
Description: NF12873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12873_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 5 - 343
Target Start/End: Original strand, 48965695 - 48966032
Alignment:
| Q |
5 |
aacacaccacacatgtgatctgacctttctacattttctgattcactacatatgatgtttgcatcattgttttgttggcttttgcatttgatcattcaac |
104 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
48965695 |
aacaaaccacacatgtgatctgacctttctacattttctgattaactacatatgatgtttgctacattgttttgttggcttt-gcattggatcattcaac |
48965793 |
T |
 |
| Q |
105 |
attgcatctgtttactaaaacaaaaatcacaaacactgataatgaatgttaattagtctaatttaagaaccagcaatagcagcaatgcctggtgctcttt |
204 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48965794 |
attgcatctgtttactaaaaagaaaatcacaaacactaataatgaatgttaattagtataatttaagaaccagcaatagcagcaatgcctggtgctcttt |
48965893 |
T |
 |
| Q |
205 |
cgtaagagcaacaaactgtgatgtgaggccaaatggttataattggcttccatggagctcttcttttctaaaatcatatagcaacctgatgtggctgcaa |
304 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48965894 |
cttaagagcaacaaactgtgatgtgaggccaaatggttataattggcttccatggagctcttcttttctaaaatcatatagcaacctgatgtggctgcaa |
48965993 |
T |
 |
| Q |
305 |
tccaagctctcttgccagtggtaatttcttcacaggttc |
343 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
48965994 |
tccaagctctcttgccagttgtaatttctttacaggttc |
48966032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University