View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12874_low_3 (Length: 255)
Name: NF12874_low_3
Description: NF12874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12874_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 16 - 246
Target Start/End: Original strand, 30337257 - 30337487
Alignment:
| Q |
16 |
caagttgcatatatttatagaaaattgctcacaccctttcatggatacttgcatcaatttacatgaacacttgcatactttcacacgagttatcataaat |
115 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |||| ||||||||| |
|
|
| T |
30337257 |
caagttacatatatttatagaaaattgctcacatcctttcatggatacttgcatcaatttacatgaacacttgcatcctttcacaggagtcatcataaat |
30337356 |
T |
 |
| Q |
116 |
taactataataattaagttattcttacatgacagtccaaatagccatttgcatatttaattatgtctttgaattttctttcnnnnnnnngaatatgtctt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
30337357 |
taactataataattaagttattcttacatgacagtccaaatagccatttgcatatttaattatgtctttgaattttctttcaaaaaaaaaatcatgtctt |
30337456 |
T |
 |
| Q |
216 |
tgaatttcaaggatctttatcatattcatct |
246 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |
|
|
| T |
30337457 |
tgaatttcaaggatctttatcgtattcatct |
30337487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University