View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12876_low_4 (Length: 288)
Name: NF12876_low_4
Description: NF12876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12876_low_4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 8 - 288
Target Start/End: Original strand, 28265163 - 28265442
Alignment:
| Q |
8 |
gagaagcagagagcataacgaggagaggcaaagcagtcgaaatagagagagggacaggggaagagatcgagacagggattatggacgagaacgggaccga |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28265163 |
gagaaacagagagcataacgaggagaggcaaagcagtcgaaatagagagagggacaggggaagagatcgagacagggattatggacgagaacgggaccga |
28265262 |
T |
 |
| Q |
108 |
agtagacaccgatattaaaaatagcagtagaagtgcattctgatgtcttgactatatggttatgtgtaaccttttttgcgaaggatttcaattgctttga |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
28265263 |
agtagacaccgatattaaaaatagcagtagaagtgcattctgatgtcttgactatatagttatgtgtaacc-tttttgggaaggatttcaattgctttga |
28265361 |
T |
 |
| Q |
208 |
attaaatccttaaattggggattgatatcctgcaatgcgatgaatgcatggaccatttgtataacctaagatatttgtgtt |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28265362 |
attaaatccttaaattggggattgatatcctgcaatgcgatgaatgcatggaccatttgtataacctaagatatttgtgtt |
28265442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University