View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12876_low_5 (Length: 248)
Name: NF12876_low_5
Description: NF12876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12876_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 28265420 - 28265657
Alignment:
| Q |
1 |
gtataacctaagatatttgtgttgttactgtatttccatggacaaatttctatttgagaatatgaatatgcacaatagactgaacttagttagtttgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28265420 |
gtataacctaagatatttgtgttgttacagtatttccatggacaaatttctatttgagaatatgaatatgcacaatagactgaacttagttagtttgttg |
28265519 |
T |
 |
| Q |
101 |
tctgtcgtttttgtgcatcgtgttttctga---aataagtaatgacccggtggaatcgacaaaagaccacaggtaaacggtatgct--aaaaaatggtgg |
195 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28265520 |
tctgtcgtttttgtgtatcgtgttttctgaaataataagtaatgacccggtggaatcgacaaaagaccacaggtaaacggtatgctaaaaaaaatggtgg |
28265619 |
T |
 |
| Q |
196 |
cttttccaggtgtggtatttgtaaagataaattgatgt |
233 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
28265620 |
cttttccaggtgtgttatttgtaaagataatttgatgt |
28265657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University