View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12876_low_6 (Length: 237)
Name: NF12876_low_6
Description: NF12876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12876_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 2 - 81
Target Start/End: Original strand, 15714759 - 15714838
Alignment:
| Q |
2 |
gttggagtagtctataaggcctagttcaactcaaaatatttgcattcaagttcaaattcttgagctagcaattgtgtgtc |
81 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15714759 |
gttggagtagtctataagacctagttcaactgaaaatattttcattcaagttcaaattcttgagctagcaattgtgtgtc |
15714838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 96 - 177
Target Start/End: Complemental strand, 36064826 - 36064745
Alignment:
| Q |
96 |
atttctgcttcaagaaatacacctaaaccttacaagaaaaatcatcggtgaaaatcacgaagtacctgaaacaacctatgga |
177 |
Q |
| |
|
|||| |||||||||||| ||||| |||| ||||||||||||||||||||||||||||| | ||||||||||| || ||||| |
|
|
| T |
36064826 |
atttttgcttcaagaaacacacccaaacgttacaagaaaaatcatcggtgaaaatcaccacatacctgaaacaccccatgga |
36064745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 86 - 135
Target Start/End: Original strand, 15715044 - 15715096
Alignment:
| Q |
86 |
aagacttcaaatttctgcttcaagaaatacacc---taaaccttacaagaaaa |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
15715044 |
aagacttcaaatttctgcttcaagaaatacaccttataaaccttacatgaaaa |
15715096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University