View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12877_high_52 (Length: 250)
Name: NF12877_high_52
Description: NF12877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12877_high_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 26691421 - 26691313
Alignment:
| Q |
4 |
aatcatgtagctatatttttagtatttgcaactctcattgtttataatacattaatgcttatttttcatattaaattgaagaggatgtacttgccctccc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26691421 |
aatcatgtagctatatttttagtatttgcaactctcattgtttataatacattaatgcttatttttcatattaaattgaagaggatgtacttgccctccc |
26691322 |
T |
|
| Q |
104 |
ttacctata |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
26691321 |
ttacctata |
26691313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 209 - 248
Target Start/End: Complemental strand, 26691217 - 26691178
Alignment:
| Q |
209 |
gatttttcaattattgaaagaatgcattcatctctctcga |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26691217 |
gatttttcaattattgaaagaatgcattcatctttctcga |
26691178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University