View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12877_high_56 (Length: 242)
Name: NF12877_high_56
Description: NF12877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12877_high_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 19 - 160
Target Start/End: Complemental strand, 28378185 - 28378044
Alignment:
| Q |
19 |
agttgagattattttgttgacatcttgcatcgacaaaacaatgttattacgtcgcgtcggaggatattctatgcttgccgctctttgcatgttgcaggag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28378185 |
agttgagattattttgttgacatcttgcatcgacaaaacaatgttattacgtcgcgtcggaggatattctatgcttgccgctctttgcatgttgcaggag |
28378086 |
T |
 |
| Q |
119 |
ttcaaagatgttcttttttctaatatgatttgtatcaatatt |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28378085 |
ttcaaagatgttcttttttctaatatgatttgtatgaatatt |
28378044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University