View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12877_high_64 (Length: 237)
Name: NF12877_high_64
Description: NF12877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12877_high_64 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 2483744 - 2483520
Alignment:
| Q |
1 |
attggagaaattgcttcgcggatcggtcaattgtattttggacaatatatgaaaacttctgattacaattatttatcagaatcttatattttctatgaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2483744 |
attggagaaattgcttcgcggatcggtcaattgtattttggacaatatatgaaaacttctgattacaattatttatcagaatcttatattttctatgaag |
2483645 |
T |
|
| Q |
101 |
ccattttcacgcgcgattatttcagagagggattgttttcggatgttaatattgcgaataagcagttgaggtttttggcgaggtttttgacggtgtgttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2483644 |
ccattttcacgcgcgattatttcagagagggattgttttcggatgttaatattgcgaataagcagttgaggtttttggcgaggtttttgacagtgtgttt |
2483545 |
T |
|
| Q |
201 |
gcttttgaatcggagggaaatgttg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2483544 |
gcttttgaatcggagggaaatgttg |
2483520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University