View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12877_high_71 (Length: 224)
Name: NF12877_high_71
Description: NF12877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12877_high_71 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 35481131 - 35481346
Alignment:
| Q |
1 |
cgctttgctactaactcagtcttccatgagcgaacgaaccatttggagatagattgccacattgtgtgtgataaattgcaagcttgagtgatacagttgc |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35481131 |
cgctttgctactaactcggtcttccatgagagaacgaaccatttggagatagattgccacattgtgtgtgataaattgcaagcttgagtgatacagttgc |
35481230 |
T |
 |
| Q |
101 |
aacttgttacctctctgaataaattggttgatttcttccccaaatcccttcttcctgagccattttctaatatgagttctaagatgaatttggttaatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35481231 |
aacttgttacctctctgaataaattggttgatttcttccccaaatcccttcttcctgagccattttctaatatgagttctaagatgaatttggttaatat |
35481330 |
T |
 |
| Q |
201 |
ttatcggtcttcatct |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
35481331 |
ttatcggtcttcatct |
35481346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University