View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12877_low_29 (Length: 367)
Name: NF12877_low_29
Description: NF12877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12877_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 115 - 339
Target Start/End: Original strand, 55071704 - 55071928
Alignment:
| Q |
115 |
gcatcatatacttggctttactttgaatggactaaataatctcgcattgccagtttctgtccctgcacaaaatcttaatttcacatggcaggtggggtgt |
214 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55071704 |
gcatcatatacttggctttactatgaatggactaaataatctcgcattgccagtttctgtccctgcacaaaatcttaatttcacatggcaggtggggtgt |
55071803 |
T |
 |
| Q |
215 |
gtggaaagactaaagagagctgccaataactaaaaacatgcagatttcatattacgaaacgccttgaggaaattaaataaatctgaaaccctttatacaa |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
55071804 |
gtggaaagactaaagagaactgccaataactaaaaacatgcagatttcatattacgaaacgccttgaggaaattaaataaatctgaaactctttatacaa |
55071903 |
T |
 |
| Q |
315 |
attttaccccaaaaaatgctcctgg |
339 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
55071904 |
attttaccccaaaaaatgctcctgg |
55071928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 10 - 76
Target Start/End: Original strand, 55071597 - 55071665
Alignment:
| Q |
10 |
gcacagagatgatccgtacacata--agtacagcacgtttgtcagacaactcatgcatgttctgttccc |
76 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55071597 |
gcacagagatgatccgtacacatataagtacagcacgtttgtcagacaactcatgcatgttctgttccc |
55071665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University