View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12877_low_44 (Length: 302)
Name: NF12877_low_44
Description: NF12877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12877_low_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 25 - 282
Target Start/End: Original strand, 43868657 - 43868916
Alignment:
| Q |
25 |
tttttgagactaaactatgaagaggttattactgaatggagcaggcaaggttctccttctccatggactactgcaaaccctcctaagttcaattgtgatg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43868657 |
tttttgagactaaactatgaagaggttattactgaatggagcaggcaaggttctccttctccatggactactgcaaaccctcctaagttcaattgtgatg |
43868756 |
T |
 |
| Q |
125 |
atgattcatggcaaaacttattggtacttcaacttttca--nnnnnnnncaatcatctcttttacactatactaaagaagacattaaattagcaacaaaa |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43868757 |
atgattcatggcaaaacttattggtacttcaacttttcattttttttctcaatcatctcttttacactatactaaacaagacattaaattagcaacaaaa |
43868856 |
T |
 |
| Q |
223 |
atttagcgataacataatttagatattttattttttccatatgtaattgaaacgactagg |
282 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43868857 |
atttagtgataacataatttagatattttattttttccatatgtaattgaaacgactagg |
43868916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 26 - 82
Target Start/End: Complemental strand, 21188411 - 21188355
Alignment:
| Q |
26 |
ttttgagactaaactatgaagaggttattactgaatggagcaggcaaggttctcctt |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21188411 |
ttttgagactaaactatgaagaggttattactgaatggagcaggcaaggttctcctt |
21188355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University