View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12877_low_51 (Length: 261)
Name: NF12877_low_51
Description: NF12877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12877_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 14 - 237
Target Start/End: Complemental strand, 5056091 - 5055871
Alignment:
| Q |
14 |
catagattgctcacacaagaactcatactagaccttgagattaataaagaacattttcaatcctaagaaggtatcaaatggagcactatgacatccctga |
113 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5056091 |
catagattgctcacacaagaactcagactagaccttgagattaataaagaacattttcaatcctaagaaggtatcaaatggagcactatgacatccctga |
5055992 |
T |
 |
| Q |
114 |
agaaatacatgttgcatacttaatagaagaagaaatggaagaccccacttcagaaaggttcaacttcaccaccttaggcaatttctggaggctgcaagta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5055991 |
agaaatacatgttgcatacttaatagaagaagaaatggaagaccccacttcagaaaggttcaactt---caccttaggcaatttctggaggctgcaagta |
5055895 |
T |
 |
| Q |
214 |
atatcaagatacttattattaaaa |
237 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5055894 |
atatcaagatacttattattaaaa |
5055871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University