View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12877_low_54 (Length: 253)
Name: NF12877_low_54
Description: NF12877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12877_low_54 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 50 - 235
Target Start/End: Original strand, 38591344 - 38591542
Alignment:
| Q |
50 |
tgcaatattcaagcattttatgatgaaaattcagaacttcttaaattagctagagacaataaagcacgaaccaattaagttaaaatcattgcaagtttgc |
149 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38591344 |
tgcaatattcaagcattttatgatgagaattcagaacttcttaaattagctagagacaataaagcacgaaccaattaagttaaaatcattgcaagtttgc |
38591443 |
T |
 |
| Q |
150 |
aaccaa-------------aattgcatttctactttaaatcaatgatgtatatggtttataatagtgtannnnnnngcttatatcaatgtagtagaata |
235 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38591444 |
aaccaaaagttacctacttaattgcatttctactttaaatcaatgatgtatatggtttataatagtgtatttttttgcttatatcaatgtagtagaata |
38591542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 11 - 54
Target Start/End: Original strand, 38591285 - 38591328
Alignment:
| Q |
11 |
cacagactcggaatatgcaattgccgtgacttttgtatgtgcaa |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38591285 |
cacagactcggaatatgcaattgccgtgacttttgtatgtgcaa |
38591328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University