View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12877_low_55 (Length: 253)
Name: NF12877_low_55
Description: NF12877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12877_low_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 4 - 243
Target Start/End: Complemental strand, 14767173 - 14766936
Alignment:
| Q |
4 |
gcattgaactagtgtacattatgatctagaatcatgtataagtatctctacccaaatcagagttgtacaagcaacgcatcttcataaaccaatttgatta |
103 |
Q |
| |
|
||||||||| |||| ||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14767173 |
gcattgaaccagtgaacattatgatcgagaatcatgtatcagtatctctacccaaatcagagttgtacaagcaacgcatcttcataaaccaatttgattc |
14767074 |
T |
 |
| Q |
104 |
ctatatctttctatctcaattctcaacaaatttgtggatggaaaggnnnnnnnnnnntacgaagaagaacatatagcacaacatgccaaactgaatataa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| || | |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14767073 |
ctatatctttctatctcaattctcaacaaatttgtggatgaaaaggaaaaaaaaaaata--acgaagaaaatatagcacaacatgccaaactgaatataa |
14766976 |
T |
 |
| Q |
204 |
gaaaagtacctcattcaacatcctatgtagctcatctctg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14766975 |
gaaaagtacctcattcaacatcctatgtagctcatctctg |
14766936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 206 - 243
Target Start/End: Complemental strand, 14761600 - 14761563
Alignment:
| Q |
206 |
aaagtacctcattcaacatcctatgtagctcatctctg |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14761600 |
aaagtacctcattcaacatcctatgtaactcatctctg |
14761563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University