View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12877_low_56 (Length: 251)
Name: NF12877_low_56
Description: NF12877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12877_low_56 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 8 - 251
Target Start/End: Complemental strand, 2484096 - 2483853
Alignment:
| Q |
8 |
gagcacagaagaaggttgaagaagaagacgaaaatggcgcagcagcaacaacagcagctgaacagcaacatcccagttagtgaagttttctggactctcg |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2484096 |
gagctcagaagaaggttgaagaagaagacgaaaatggcacagcagcaacaacagcagctgaacagcaacatcccagttagcgaagttttctggactctcg |
2483997 |
T |
 |
| Q |
108 |
tcgacaaagccgacaaaaaattctccaaaatcagagacttaccttattaccaacgctccaggttcgtacgtcacaaaaccctaaccctaattcctctttt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2483996 |
tcgacaaagccgacaaaaaattctccaaaatcagagacttaccttattaccaacgctccaggttcgtacgtcacaaaaccctaaccctaattcctctttc |
2483897 |
T |
 |
| Q |
208 |
aaaaccctaactctaattgcattttcattttcttaattaattat |
251 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2483896 |
aaaactctaactctaattgcattctcattttcttaattaattat |
2483853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University