View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12877_low_57 (Length: 250)
Name: NF12877_low_57
Description: NF12877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12877_low_57 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 69 - 250
Target Start/End: Complemental strand, 41617118 - 41616937
Alignment:
| Q |
69 |
ttcttctggtgaggcgaaggagaggaagcgtggacagagtgaataaggtggtcggattcggaggtgtggatgtgcaagggttttcaggtgggtgagaaat |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41617118 |
ttcttctggtgaggcgaaggagaggaagcgtggacagagtgaataaggtggtcggattcggaggtgtggatgtgcaagggttttcaggtgggtgagaaat |
41617019 |
T |
|
| Q |
169 |
gttgctttagagagagccatggttgagtgtgagaggaagatagactataaatcacctgcacatttaaacaaacaacagagtc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41617018 |
gttgctttagagagagccatggttgagtgtgagaggaagatagactataaatcacctgcacatttaaacaaacaacagagtc |
41616937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 10 - 44
Target Start/End: Complemental strand, 41617177 - 41617143
Alignment:
| Q |
10 |
gcagagagagggggttcgatgcggagttgtcgctt |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41617177 |
gcagagagagggggttcgatgcggagttgtcgctt |
41617143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 69 - 108
Target Start/End: Complemental strand, 51277272 - 51277233
Alignment:
| Q |
69 |
ttcttctggtgaggcgaaggagaggaagcgtggacagagt |
108 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51277272 |
ttctactggtgaggcgaaggagagaaagcgtggacagagt |
51277233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University