View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12877_low_61 (Length: 247)
Name: NF12877_low_61
Description: NF12877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12877_low_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 25453578 - 25453807
Alignment:
| Q |
1 |
ctgatattctaagtaaacggtaagagcaacnnnnnnnnngtccaccaacttgctctacaaagcaccacttcggccatgagtttcgcttaacatcgtcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25453578 |
ctgatattctaagtaaacggtaagagcaacaaaaaaaaagtccaccaacttgctctacaaagcaccacttaggccatgagtttcgcttaacatcgtcaat |
25453677 |
T |
 |
| Q |
101 |
attactgccaagcataggccctaaacaagtgccttgagatgcatttaggatgcttcgattttcccaatcacaagaacttgatttcatgcctagtgcaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25453678 |
attactgccaagcataggccctaaacaagtgccttgagatgcatttaggatgcttcgattttcccaatcacaagaacttgatttcatgcctagtgcaagg |
25453777 |
T |
 |
| Q |
201 |
catcacttggattttgagggaccgcttgtg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25453778 |
catcacttggattttgagggaccgcttgtg |
25453807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University