View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12877_low_65 (Length: 239)
Name: NF12877_low_65
Description: NF12877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12877_low_65 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 26691497 - 26691736
Alignment:
| Q |
1 |
ttgatacgtttgagtttgtaagaaaatgatagaaatatattttagtgtaaattgcttttatgatatgnnnnnnnnn--gttgcataaccttgattttctt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26691497 |
ttgatacgtttgagtttgtaagaaaatgatagaaatatattttagtgtaaattgcttttatgatatgtttttttttttgttgcataaccttgattttctt |
26691596 |
T |
 |
| Q |
99 |
aattaacaa----------ggcaataacagggtattggtttaagtgataaaatatttgaactctataaataaattatcatagtttcaattcttgatact- |
187 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26691597 |
aattaacaaagaaatttaaggcaataatagggtattggtttaagtgataaaatatttgaactctataaataaatgatcatagtttcaattcttgatactt |
26691696 |
T |
 |
| Q |
188 |
---tacaaagattattctttgtttgatagtggttaaaatt |
224 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
26691697 |
acatacaaagattattctttgtttgaaagtggtgaaaatt |
26691736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University