View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12877_low_71 (Length: 235)
Name: NF12877_low_71
Description: NF12877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12877_low_71 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 47893869 - 47894086
Alignment:
| Q |
1 |
cgccggagagaccctcaaaaatacaattattccggcaatccttgccctgagtttcgcaaattaggaaactgcaccaaaggtgattcttgccacttcgctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47893869 |
cgccggagagaccctcaaaaatacaattattccggcaatccttgcccggagtttcgcaaattaggaaactgcaccaaaggtgattcttgccacttcgctc |
47893968 |
T |
 |
| Q |
101 |
atggtgtttttgaatgctggcttcatccttctcgttacagaactcagctttgtaacgacggaaccctttgccggagacgagtttgtttctttgctcatac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47893969 |
atggtgtttttgaatgctggcttcatccttctcgttacagaactcagctttgtaacgacggaaccctttgccggagacgagtttgtttctttgctcatac |
47894068 |
T |
 |
| Q |
201 |
cattgatcaactccgtgt |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
47894069 |
cattgatcaactccgtgt |
47894086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 94 - 144
Target Start/End: Complemental strand, 38748222 - 38748172
Alignment:
| Q |
94 |
ttcgctcatggtgtttttgaatgctggcttcatccttctcgttacagaact |
144 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| || | ||||||||| |
|
|
| T |
38748222 |
ttcgctcatggcgtttttgaatgctggcttcatcctgctagatacagaact |
38748172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 76 - 165
Target Start/End: Complemental strand, 42926264 - 42926175
Alignment:
| Q |
76 |
aaaggtgattcttgccacttcgctcatggtgtttttgaatgctggcttcatccttctcgttacagaactcagctttgtaacgacggaacc |
165 |
Q |
| |
|
||||||||||| || | || |||||||||||||| || || |||||||||||||| |||||| | ||||||| ||||| ||||||||| |
|
|
| T |
42926264 |
aaaggtgattcgtgtgagtttgctcatggtgttttcgagtgttggcttcatccttcgcgttaccgtactcagccgtgtaaagacggaacc |
42926175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University