View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12877_low_72 (Length: 234)
Name: NF12877_low_72
Description: NF12877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12877_low_72 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 9 - 213
Target Start/End: Complemental strand, 40147164 - 40146961
Alignment:
| Q |
9 |
agagagatgaaaattgctttggttcccatttttccaacctgcagagagttgaataaatgaggctatactttgaattgtaactttgagagaaatgagagga |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40147164 |
agagaaatgaaaattgctttggttcccattttcccaacctgcagagagttgaataaatgaggcta--ctttgaattgtaactttgagagaaatgagagga |
40147067 |
T |
|
| Q |
109 |
cttttattcttactaaaagctgctcgaggaa-cagaaataagcaagcatgctgacaatgacaagcacaggcaactcctgccaaaccctgttaatttcagc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40147066 |
tttttattcttactaaaagctgctcgaggaaacagaaataagcaagcatgctgacaatgacaagcacaggcaactcctgccaaaccctgttaatttcagc |
40146967 |
T |
|
| Q |
208 |
agacaa |
213 |
Q |
| |
|
|||||| |
|
|
| T |
40146966 |
agacaa |
40146961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University