View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12877_low_76 (Length: 227)
Name: NF12877_low_76
Description: NF12877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12877_low_76 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 5233710 - 5233498
Alignment:
| Q |
1 |
tgaagtccaataaggaggaaacccaatgttgatgcatcggctagacaggaagacctggcacgaaaattgctcttaacgttatcgtagaagataaacagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5233710 |
tgaagtccaataaggaggaaacccaatgttgatgcatcggctagacaggaagacctggcacgaaaattgctcttaacgttatcgtagaagataaacagat |
5233611 |
T |
|
| Q |
101 |
aaggactaaggattacagtttttctgtgcattcgtgaagttttgtttcgcttcatatagcagtactggtctagaaaatcctctgtgtttcagaccggaaa |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5233610 |
aaggactaaggattacagttttgctgtgcattcgtgaagttttgtttcgcttcatatagcagtactggtctagaaaatcctctgtgtttcagatcggaaa |
5233511 |
T |
|
| Q |
201 |
acaccataaaaat |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5233510 |
acaccataaaaat |
5233498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University