View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12878_high_19 (Length: 239)
Name: NF12878_high_19
Description: NF12878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12878_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 14 - 223
Target Start/End: Complemental strand, 41039372 - 41039162
Alignment:
| Q |
14 |
aagaaaccagatagcttaaacttgaatgaatatactttgtcatctttcataaataatgatggatggcttgccaacgtaccatctattttattgtagttta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41039372 |
aagaaaccagatagcttaaacttgaatgaatatactttgtcatctttcataaataatgatggatggcttgccaacgtaccatctattttattgtagttta |
41039273 |
T |
|
| Q |
114 |
cttttcttgtctttggttagatatttatgattcaattgtc-ttgtttatttatgaacaaatgatgaatagctaaatatccaataaaaacgtgcattgtta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41039272 |
cttttcttgtctttggttagatatttatgattcaattgtctttgtttatttatgaacaaatgatgaatagctaaatatccaataaaaacgtgcattgtta |
41039173 |
T |
|
| Q |
213 |
ttgcacaaaat |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
41039172 |
ttgcacaaaat |
41039162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 41 - 84
Target Start/End: Original strand, 18745523 - 18745566
Alignment:
| Q |
41 |
gaatatactttgtcatctttcataaataatgatggatggcttgc |
84 |
Q |
| |
|
|||||| |||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
18745523 |
gaatattctttatcatctttcataaataaagatggatggcttgc |
18745566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 88
Target Start/End: Complemental strand, 54497809 - 54497759
Alignment:
| Q |
38 |
aatgaatatactttgtcatctttcataaataatgatggatggcttgccaac |
88 |
Q |
| |
|
||||||||| |||| ||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
54497809 |
aatgaatattctttatcatctttcataaataagaatggatggcttaccaac |
54497759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University