View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12878_high_5 (Length: 401)
Name: NF12878_high_5
Description: NF12878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12878_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 19 - 187
Target Start/End: Original strand, 12635718 - 12635887
Alignment:
| Q |
19 |
tggaaatgatttggtggaaaatcatgcagaaaatgggattttgctgctgtagtgtagcgtagccacaaactttaattt-gttttttgcattagggatttt |
117 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12635718 |
tggaaataatttggtggaaaatcatgctgaaaatgggattttgctgctgcagtgtagcgtagccacaaactttaattttgttttttgcattagggatttt |
12635817 |
T |
|
| Q |
118 |
atatggaactatttcaaatctgaatgacttagactttggtttgattatcaagcactattctaacttcaga |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12635818 |
atatggaactatttcaaatctgaatgacttagactttggtttgattatcaagcactattctaacttcaga |
12635887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 294 - 373
Target Start/End: Original strand, 12635892 - 12635972
Alignment:
| Q |
294 |
attttgattttcactcagaccacacattctaaacaatgcttacattttgtttcgatagtgagacac-ttttttacattgaa |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
12635892 |
attttgattttcactcagaccacacattctaaacaatgcttacattttgtttagatagtgagacactttttttacattgaa |
12635972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University