View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12878_low_16 (Length: 303)
Name: NF12878_low_16
Description: NF12878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12878_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 292
Target Start/End: Complemental strand, 10069815 - 10069527
Alignment:
| Q |
1 |
atatataccaactgatgctttctaaatttatataataacatcaaaagtaaataaatggagagagcattttattttgcatgtaaatgagcaaacaacgatt |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10069815 |
atatataccaattgatgctttctaaatttatataataacatcaaaagtaaataaatggagagagcattttattttgcatgtaaatgagcaaacaatgatt |
10069716 |
T |
 |
| Q |
101 |
tatttgtcgtgtannnnnnnactcactgacataagactatcatcacactgtctacgtcatttatgctctttccctttctcttcttcttct---aatactc |
197 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
10069715 |
tatttgtcgtgtacc------ctcactgacataagactatcatcacactgtctacgtcatttacgctctttccctttctcttcttcttcttctaatactc |
10069622 |
T |
 |
| Q |
198 |
acatcaacaagtaaccatagaaactctttcttaacaatgttgcatgcaacatattctttacttttatgagttttaaactcttcgtctctctgctt |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10069621 |
acatcaacaagtaaccatagaaactctttcttaacaatgttgcatgcaacatattctttacttttatgagttttaaactcttcgtctctctgctt |
10069527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University