View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12878_low_17 (Length: 302)
Name: NF12878_low_17
Description: NF12878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12878_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 17 - 229
Target Start/End: Complemental strand, 2830676 - 2830464
Alignment:
| Q |
17 |
aaataaaaccctggttaatagcatatatgtgtaacaaacaatcttggttttatatggcaacttcttcaagaagaaatgtgggatcaatccattttgattc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2830676 |
aaataaaaccctggttaatagcatatatgtgtaacaaacaatcttggttttatatggcaacttcttcaagaagaaatgtgggatcaatccattttgattc |
2830577 |
T |
|
| Q |
117 |
ttgatataaatgcaagcgcgtgggttctgaataataaattcaaaagctgcatagtcacaactcacaagcttccaagacctttgatgcatgcagcattcct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2830576 |
ttgatataaatgcaagcgcgtgggttctgaataataaattcaaaagctgcatagtcacaactcacaagcttccaagacctttgatgcatgcagcattcct |
2830477 |
T |
|
| Q |
217 |
taattacgtacta |
229 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2830476 |
taattacgtacta |
2830464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 228 - 294
Target Start/End: Complemental strand, 2830334 - 2830268
Alignment:
| Q |
228 |
tatcaacagagagtaggtagataaacatagcttgacttgacctacatttttgcagttcgtctgtgct |
294 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2830334 |
tatcaacaaagagtaggtagagaaacatagcttgacttgacctacatttttgcagttagtctgtgct |
2830268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 104 - 168
Target Start/End: Complemental strand, 7009766 - 7009702
Alignment:
| Q |
104 |
tccattttgattcttgatataaatgcaagcgcgtgggttctgaataataaattcaaaagctgcat |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||| |
|
|
| T |
7009766 |
tccattttgattcttgatataaatgcaagcacatgggttctgaaaaataaattcaaaagctgcat |
7009702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 210
Target Start/End: Complemental strand, 7009618 - 7009589
Alignment:
| Q |
181 |
caagcttccaagacctttgatgcatgcagc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7009618 |
caagcttccaagacctttgatgcatgcagc |
7009589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University