View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12878_low_23 (Length: 224)
Name: NF12878_low_23
Description: NF12878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12878_low_23 |
 |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |
|
| [»] scaffold0314 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0085 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 33 - 224
Target Start/End: Complemental strand, 53056 - 52863
Alignment:
| Q |
33 |
gcctccaatcaggctttccagtttcttaatgcagtagagaattttcaacaatagttaattgagtataagttgcaaagattgtgctgagcataagcat--c |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
53056 |
gcctccaatcaggctttccagtttcttaatgcagtagagaattttcaacaatagttaattgagtataagttgcaaagattgtgctgagcataagcatacc |
52957 |
T |
 |
| Q |
131 |
aagttgaaaattttgtgcaatcattcaacttgcatatgtaacaaaattgaatttacaagtgtaggaatgactatttcctgttgattcaagccat |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52956 |
aagttgaaaattttgtgcaatcattcaacttgcatatgtaacaaaattgaatttacaagtgtaggaatgactatttcctgttgattcaagccat |
52863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 131 - 182
Target Start/End: Complemental strand, 17817665 - 17817614
Alignment:
| Q |
131 |
aagttgaaaattttgtgcaatcattcaacttgcatatgtaacaaaattgaat |
182 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
17817665 |
aagttaaaaattttgtgcaattattcaacttgcatatgtaaccaaattgaat |
17817614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0314 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0314
Description:
Target: scaffold0314; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 37
Target Start/End: Original strand, 20306 - 20339
Alignment:
| Q |
4 |
agttgaatatgctgtcggcctgtcacgatgcctc |
37 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
20306 |
agttgaatatgctgtcagcctgtcacgatgcctc |
20339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University