View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12878_low_24 (Length: 206)
Name: NF12878_low_24
Description: NF12878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12878_low_24 |
 | |
|
| [»] scaffold0085 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0085 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 6 - 206
Target Start/End: Original strand, 52636 - 52836
Alignment:
| Q |
6 |
actagtaaccctagaaagttcttacaaacaacaaattcgagtatacactgacatattttatattttatgttgaacttcgcgatttgctgtttttcaatgg |
105 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52636 |
actagtaaccctagaaagttcttccaaacaacaaattcgagtatacactgacatattttatattttatgttgaacttcgcgatttgctgttttttaatgg |
52735 |
T |
|
| Q |
106 |
aagatcattgtgcaaggattcaaaagaatgcttcctgatatttataataacattatatagaatacataaaaggaagtaatttgtccgagttttgcttcta |
205 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52736 |
aagatcattgtgcaaggattcaaaggaatgcttcctgatatttataataatattatatataatacataaaaggaagtaatttgtctgagttttgcttcta |
52835 |
T |
|
| Q |
206 |
a |
206 |
Q |
| |
|
| |
|
|
| T |
52836 |
a |
52836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 95 - 157
Target Start/End: Complemental strand, 52171440 - 52171378
Alignment:
| Q |
95 |
tttttcaatggaagatcattgtgcaaggattcaaaagaatgcttcctgatatttataataaca |
157 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
52171440 |
tttttcaatggaagatcgttgtgcaaggattcaaaggaatgcttccttatatttataataaca |
52171378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University