View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12879_high_13 (Length: 344)
Name: NF12879_high_13
Description: NF12879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12879_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 182 - 327
Target Start/End: Complemental strand, 46086747 - 46086602
Alignment:
| Q |
182 |
aggtgcaaattggatctcattcctttacgtatgattatgtgtatggtagcacgggacaaccttcatctacgatttacaatgattgtgtagcaccgctcgt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
46086747 |
aggtgcaaattggatctcattcctttacgtatgattatgtgtatggtagcacgggacaaccttcatctactatttacgatgattgtgtagcaccgctcgt |
46086648 |
T |
 |
| Q |
282 |
tgatgcacttttcaatggatataatgccacggttctcgcttatggt |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46086647 |
tgatgcacttttcaatggatataatgccacggttctcgcttatggt |
46086602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 4 - 106
Target Start/End: Complemental strand, 46086924 - 46086822
Alignment:
| Q |
4 |
agcgtgcgagttgccgttaacattcggcctctgatcacgtccgaacttctccttggttgcacagattgcatttctgttgttcctggcgaacctcaggtgc |
103 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46086924 |
agcgtgcgagttgccgtcaacattcggcctctgatcacgtccgaacttctccttggttgcacagattgcatttctgttgttcctggcgaacctcaggtgc |
46086825 |
T |
 |
| Q |
104 |
tac |
106 |
Q |
| |
|
||| |
|
|
| T |
46086824 |
tac |
46086822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University