View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12879_high_21 (Length: 295)
Name: NF12879_high_21
Description: NF12879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12879_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 35234582 - 35234860
Alignment:
| Q |
1 |
aaaatatattcttattttcctatggaactaaactggacttcaaatatttttcaaagaataaaacgagtcttcactcaaatataaactatagatattgtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35234582 |
aaaatatattcttattttcctatggaactaaactggacttcaaatatttttcaaagaataaaacgagtcttcactcaaatataaactatagatattgtat |
35234681 |
T |
 |
| Q |
101 |
ttatagttgtttttgtttgcattatttttcatttagaggatggtggagatagagagtgagaaagagattgttatggtgtgagaatgagagttatgtttat |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35234682 |
ttatagttgtttttgtttgcgttatttttcatttagaggatggtggagatagagagtgagaaagagattgttatggtgtgagaatgagagttatgtttat |
35234781 |
T |
 |
| Q |
201 |
tctcctatacttttgctgttggaaattatgaacacacatatatgtggattggatgtcattttcctctttctttattaacttctt |
284 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||| | |||||||||| |||||||||||||||||||||| |
|
|
| T |
35234782 |
tctcctatacttttgatgttggaaattataaacacacatatatg-----tagatgtcatttccctctttctttattaacttctt |
35234860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University