View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12879_high_36 (Length: 224)
Name: NF12879_high_36
Description: NF12879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12879_high_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 15 - 176
Target Start/End: Original strand, 39118157 - 39118318
Alignment:
| Q |
15 |
caaaggaaaagcttttatgtggtgcgcgatgatttgttgcacccggtgattaatggtaataaagcaagaaaattggatggattacttcccttgcttcatg |
114 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39118157 |
caaaggaaaagcttttatttggtgcgcgatgatttgttgcacccggtgattaatggtaataaagcaagaaaattggatggattacttcccttgcttcatg |
39118256 |
T |
 |
| Q |
115 |
attattcagtcactgatgtggtaaattatccttcaatttattactttacaacaatgtttagt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39118257 |
attattcagtcactgatgtggtaaattatccttcaacttattactttacaacaatgtttagt |
39118318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University