View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12879_low_13 (Length: 344)
Name: NF12879_low_13
Description: NF12879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12879_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 1 - 325
Target Start/End: Complemental strand, 10461925 - 10461601
Alignment:
| Q |
1 |
agagactttgagagaagctatggcggtgctcagggatatgtttggacccaacatccccgacgctattgacatacttgttccctgctggtggaataacagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461925 |
agagactttgagagaagctatggcggtgctcagggatatgtttggacccaacatccccgacgctattgacatacttgttccctgctggtggaataacagg |
10461826 |
T |
 |
| Q |
101 |
tttcagcgcggaagctacagcaactttccgattatctccaatggtaaagttttttataacattaaggtaataaggtttgcttatcatgctgcattttcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461825 |
tttcagcgcggaagctacagcaactttccgattatctccaatggtaaagttttttataacattaaggtaataaggtttgcttatcatgctgcattttcat |
10461726 |
T |
 |
| Q |
201 |
attatttaatcattgtttgacaattcccctttgaatattttctgctcttaaatatatcaattgatgctatagctatacttgtcttatatcagtgcatcca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461725 |
attatttaatcattgtttgacaattcccctttgaatattttctgctcttaaatatatcaattgatgctatagctatacttgtcttatatcagtgcatcca |
10461626 |
T |
 |
| Q |
301 |
aagacaaaacaggggatgacctgga |
325 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
10461625 |
aagacaaaacaggggatgacctgga |
10461601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University