View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12879_low_17 (Length: 327)
Name: NF12879_low_17
Description: NF12879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12879_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 18 - 174
Target Start/End: Complemental strand, 41381199 - 41381043
Alignment:
| Q |
18 |
taaacctctttgtttgcatggtgaaaaaggttgtacctttagattttattcttgaaatgaatgatagtgttggtgattttgatgttctgtttttctttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41381199 |
taaacctctttgtttgcatggtgaaaaaggttgtacctttagattttattcttgaaatgaatgatagtgttggtgattttgatgttctgtttttctttga |
41381100 |
T |
 |
| Q |
118 |
atggttgattattgttgagggttgttttgaaatgaaaataatttatctgcatgttga |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41381099 |
atggttgattattgttgagggttgttttgaaatgaaaataatttatctgcatgttga |
41381043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 186 - 316
Target Start/End: Complemental strand, 41381010 - 41380880
Alignment:
| Q |
186 |
gtatctttgaatttcaatcatgaaatgttaatgatgatctaggttagttgttttctattgttggtttttggaaattttgaatttttgtcagagaaaaagt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41381010 |
gtatctttgaatttcaatcatgaaatgttaatgatgatctaggttagttgttttctattgttggtttttggaaattttgaatttttgtcagagaaaaagt |
41380911 |
T |
 |
| Q |
286 |
gtgatttgctattttcatgttatagcccttt |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41380910 |
gtgatttgctattttcatgttatagcccttt |
41380880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University