View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12879_low_28 (Length: 273)
Name: NF12879_low_28
Description: NF12879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12879_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 32 - 255
Target Start/End: Original strand, 43918312 - 43918536
Alignment:
| Q |
32 |
aatcaaagatttcgctcggaagtccctcaacatcagagtccataacctgccacgagcacattaccagttattgtaaaggaaa-gtacactaaaaaatcag |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43918312 |
aatcaaagatttcgctcggaagtccctcaacatcagagtccataacctgccacgagcacattaccagttattgtaaaggaaaagtacactaaaaaatcag |
43918411 |
T |
|
| Q |
131 |
gtgcattataaacagcaatttgtctcagttttacttcaagaagctcccgagataatttgaaaggtgcactttcaaaattaacaccaccaggtgaattgga |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
43918412 |
gtgcattataaacagcaatttgtctcagttttacttcaagaagctcccgagataatttgaaaggtgcattttcaaaattaacaccaccaggcgaattgga |
43918511 |
T |
|
| Q |
231 |
aagcatgaagccaaaatcgatatgt |
255 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43918512 |
aagcatgaagccaaaatcgatatgt |
43918536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 160 - 255
Target Start/End: Complemental strand, 39128506 - 39128411
Alignment:
| Q |
160 |
tttacttcaagaagctcccgagataatttgaaaggtgcactttcaaaattaacaccaccaggtgaattggaaagcatgaagccaaaatcgatatgt |
255 |
Q |
| |
|
||||| ||||||||||| || | |||||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
39128506 |
tttacctcaagaagctcacgtgttaatttaaaaggtgcactttcaaaattaaccccaccaggtgaattggatagcatgaagccaaaatcaatatgt |
39128411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University