View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12879_low_29 (Length: 272)
Name: NF12879_low_29
Description: NF12879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12879_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 21397773 - 21397523
Alignment:
| Q |
1 |
gatgatgacattggtgataaattgaatagtaatgcatgctccaaaggcaatatgaacattggcaccacgaccatctatggtcttaaaactgttcatgatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21397773 |
gatgatgacattggtgataaattgaatagtaatgcatgctccaaaggcaatatgaacattggcaccacgaccatctatggtcttaaaactgttcatgatc |
21397674 |
T |
|
| Q |
101 |
aattcttgcttcagggtgatcaccatgtctctcttgaacacaatccacaatggcctatcttgaatgacggcgtgacggagagtgccaggtcttgggttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21397673 |
aattcttgcttcagggtgatcaccatgtctctcttgaacacaatccacaatggcctatcttgaatgacggcgtgacggagagtgccaggtcttgggttca |
21397574 |
T |
|
| Q |
201 |
cagggtcgtcatctcttgggttattcacaacgtagtaccttccgtcgcggc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21397573 |
cagggtcgtcatctcttgggttattcacaacgtagtaccttccgtcgcggc |
21397523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 122 - 249
Target Start/End: Complemental strand, 17909812 - 17909685
Alignment:
| Q |
122 |
accatgtctctcttgaacacaatccacaatggcctatcttgaatgacggcgtgacggagagtgccaggtcttgggttcacagggtcgtcatctcttgggt |
221 |
Q |
| |
|
|||||||||||||||||||||||||| | ||| |||||||| || |||||||| || | ||| || || || ||||| |||||||| ||||||||||||| |
|
|
| T |
17909812 |
accatgtctctcttgaacacaatccaaagtggtctatcttggataacggcgtggcgcaaagttcctggcctagggttaacagggtcatcatctcttgggt |
17909713 |
T |
|
| Q |
222 |
tattcacaacgtagtaccttccgtcgcg |
249 |
Q |
| |
|
| | ||||| |||||| |||| ||||| |
|
|
| T |
17909712 |
cagtgacaacatagtactttccatcgcg |
17909685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University