View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12879_low_30 (Length: 253)
Name: NF12879_low_30
Description: NF12879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12879_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 17 - 245
Target Start/End: Complemental strand, 31413515 - 31413287
Alignment:
| Q |
17 |
acttaagagatcaaacatgcaattagccaaacatataatatcaaaaactatgtattcaataatttaaaagtttaaccatttatatttttaatgagggggt |
116 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31413515 |
acttaagagatcaaacatgcaattagtcaaatatataatattaaaaactatgcattcaataatttaaaagtttaaccatttatatttttaacgagggggt |
31413416 |
T |
 |
| Q |
117 |
ggatttagcgtacggcttggtgtggcttttccccaattttccttaaatgttatttagataccgatattttgaaattcagtcgctaaatacattggagact |
216 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31413415 |
ggatttagcgtacggcttggtggggcttttccccaattttgcttaaatgctatttagataccgatattttgaaattcagtcgctaaatacattagagact |
31413316 |
T |
 |
| Q |
217 |
gaattagcgctcaattttattcctttgct |
245 |
Q |
| |
|
||||||||||||||||||||| ||||||| |
|
|
| T |
31413315 |
gaattagcgctcaattttatttctttgct |
31413287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University