View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12879_low_32 (Length: 250)
Name: NF12879_low_32
Description: NF12879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12879_low_32 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 33635285 - 33635063
Alignment:
| Q |
18 |
ggccttgacaaatggtttccaactctctctacatgcattccaattgaaggaatatccggcaaacccggttgtgtccgattttgtgccggtttcaagactc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33635285 |
ggccttgacaaatggtttccaactctctctacatgcattccaattgaaggaatatccggcaaacccggttgtgtccgattttgtgccggtttcaagactc |
33635186 |
T |
|
| Q |
118 |
ctgtggatgaagatggcaaacaatctttgaattggacaaagcagaaacttctttcaattgatccaattcaaagggtgtttacctatgcaattattgatgg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33635185 |
ctgtggatgaagatggcaaacaatctttgaattggacaaagcagaaacttctttcaattaatccaattcaaagggtgtttacctatgcaattattgatgg |
33635086 |
T |
|
| Q |
218 |
aaatgttggattttattcctatg |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33635085 |
aaatgttggattttattcctatg |
33635063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 21 - 240
Target Start/End: Complemental strand, 33650430 - 33650211
Alignment:
| Q |
21 |
cttgacaaatggtttccaactctctctacatgcattccaattgaaggaatatccggcaaacccggttgtgtccgattttgtgccggtttcaagactcctg |
120 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
33650430 |
cttgataaatggtttccaactctctcttattgcattccagttgaaggaatatccggcaaacccggttgtgtccgattctgtgccggtttcaagactccag |
33650331 |
T |
|
| Q |
121 |
tggatgaagatggcaaacaatctttgaattggacaaagcagaaacttctttcaattgatccaattcaaagggtgtttacctatgcaattattgatggaaa |
220 |
Q |
| |
|
| ||| || ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
33650330 |
ttgataaacatggcaaacaaaacttgaattggactaagcagaaacttctttcaattgatccaattcaaagggtgtttagctatgcaattgttgatggaaa |
33650231 |
T |
|
| Q |
221 |
tgttggattttattcctatg |
240 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
33650230 |
tgttggatttcattcctatg |
33650211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University