View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12879_low_38 (Length: 235)
Name: NF12879_low_38
Description: NF12879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12879_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 223
Target Start/End: Complemental strand, 12066320 - 12066116
Alignment:
| Q |
20 |
ctcaattcattcataaacttcattcataacattcttacttatctaccnnnnnnnnttcttagtttgaagaaaagaaggaagaaatacttcatataactct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12066320 |
ctcaattcattcataaacttcattcataacattcttagttatctaccaaaaataattcttagtttgaagaaaagaaggaagaaatacttcatacaactct |
12066221 |
T |
 |
| Q |
120 |
actgaaaaaatttcaggttagttaatcacactcaaatattatatcatattttagttcttacttctgaatt-ttttatttactattcttgatgaaaattct |
218 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12066220 |
actgaaaaattttcaggttagttaatcacactcaaatattatatcatattttagttcttacttctgaatttttttatttactattcttgatgaaaattct |
12066121 |
T |
 |
| Q |
219 |
tctca |
223 |
Q |
| |
|
||||| |
|
|
| T |
12066120 |
tctca |
12066116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University