View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12879_low_39 (Length: 224)

Name: NF12879_low_39
Description: NF12879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12879_low_39
NF12879_low_39
[»] chr3 (1 HSPs)
chr3 (15-176)||(39118157-39118318)


Alignment Details
Target: chr3 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 15 - 176
Target Start/End: Original strand, 39118157 - 39118318
Alignment:
15 caaaggaaaagcttttatgtggtgcgcgatgatttgttgcacccggtgattaatggtaataaagcaagaaaattggatggattacttcccttgcttcatg 114  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39118157 caaaggaaaagcttttatttggtgcgcgatgatttgttgcacccggtgattaatggtaataaagcaagaaaattggatggattacttcccttgcttcatg 39118256  T
115 attattcagtcactgatgtggtaaattatccttcaatttattactttacaacaatgtttagt 176  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
39118257 attattcagtcactgatgtggtaaattatccttcaacttattactttacaacaatgtttagt 39118318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University