View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12879_low_40 (Length: 219)
Name: NF12879_low_40
Description: NF12879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12879_low_40 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 8 - 219
Target Start/End: Complemental strand, 32704735 - 32704517
Alignment:
| Q |
8 |
ttactggaattctgcatacctagaatcaacgagaacccctcacctaatgagtaa------aaagtttagaggcactctagaagaaggcatggatttatta |
101 |
Q |
| |
|
||||||||||| ||||| || |||||||||||||||||||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32704735 |
ttactggaattttgcatgccgagaatcaacgagaacccctcgcctaatgagtacgaagagaaagtttagaggcactgtagaagaaggcatggatttatta |
32704636 |
T |
 |
| Q |
102 |
gagatcaaggtcaaagacaacattggagttcatggtccatcnnnnnnnttcatctcaagagatgagagattagaaggccatggaagcaaaaccc-aaggc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32704635 |
gagatcaaggtcaaagacaacattggagttcatggtccatcaaaaaaattcatctcaagagatgagagattagaaggccatggaagcaaaacccaaaggc |
32704536 |
T |
 |
| Q |
201 |
gataggcataactaggaca |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
32704535 |
gataggcataactaggaca |
32704517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University