View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12879_low_9 (Length: 423)
Name: NF12879_low_9
Description: NF12879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12879_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 370; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 370; E-Value: 0
Query Start/End: Original strand, 17 - 410
Target Start/End: Complemental strand, 45552340 - 45551947
Alignment:
| Q |
17 |
ttctcctcttctacgtcccggcaacacataatttccataaacatttttccattttgtcacagtcactgctaaattatggctaagagatcagattttgcac |
116 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45552340 |
ttctcctcttctacgtcccggcaccacataatttccataaacatttttccattttgtcacagtcactgctaaattatggctaagagatcagattttgcac |
45552241 |
T |
 |
| Q |
117 |
agaagcttcttgatgatctgcgcgtaaggaaagaacgaatggctgttactgcatctcattctcaaaactcaaaccaatcctaccatttgcctataggtag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45552240 |
agaagcttcttgatgatctgcgcgtaaggaaagaacgaatggctgttactgcatctcattctcaaaactcaaaccaatcctaccatttgcctataggtag |
45552141 |
T |
 |
| Q |
217 |
taatgttttcagtttataattatatatccattcatacaacaatttcatagcttcatttattttaatatcaatgagccattttattaatcttttgccactt |
316 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45552140 |
taacgttttcagtttataattatatatccattcatacaacaatttcatagcttcatttattttaatatcaatgagccattttattaatcttttggcactt |
45552041 |
T |
 |
| Q |
317 |
ctttgctctttgctatgatagagcagtgcaattcatagagaagctgctaaatatactttaacatatgaaaacttgtgtccaaacaagatatttc |
410 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45552040 |
ctttgctcttcgctatgatagagcagtgcaattcatagagaagctgctaaatatacttcaacatatgaaaacttgtgtccaaacaaaatatttc |
45551947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University