View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12880_high_5 (Length: 281)
Name: NF12880_high_5
Description: NF12880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12880_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 17 - 266
Target Start/End: Original strand, 4554947 - 4555196
Alignment:
| Q |
17 |
aaatttgatttttagtctcaaatttattgtttgattcatttttgcgtgaatttatatgaacataagtaaataattttacactcaattcatttttaatcaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4554947 |
aaatttgatttttagtctcaaatttattgtttgattcatttttgcgtgaatttatttgaacataagtaaataattttacactcaactcatttttaatcaa |
4555046 |
T |
 |
| Q |
117 |
aatactttcgtcaaaatcaatttttgcccctgcaaaacaaaacacactaattagtaattactacatgttttcttattgccaaatcactaatactactcta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4555047 |
aatactttcgtcaaaatcaatttttgcccctgcaaaacaaaacacactaattagtaattactacatgttttcttattgccaaatcactaatactactcta |
4555146 |
T |
 |
| Q |
217 |
tgaatcttcatataaatatgtaatcagatggctcccagttacaattcagt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4555147 |
tgaatcttcatataaatatgtaatcagatggctcccagttacaattcagt |
4555196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University